Analysis of p53 mutants for transcriptional activity.
نویسندگان
چکیده
منابع مشابه
Inactive p53 mutants may enhance the transcriptional activity of wild-type p53.
The p53 mutants 248Trp, 175His, and 281Gly fail to activate transcription mediated by p53CON element (GGACATGCCCGGGCATGTCC) or the ribosomal gene cluster element (ACGTTTGCCTTGCCTGGACTTGCCTGGCCTTGCCTT). We studied the effect of these inactive p53 mutants on the transcriptional activity of wild-type p53 by cotransfection of both wild-type and mutant p53 expression vectors into p53-null K562 chron...
متن کاملPrediction of P53 Mutants (Multiple Sites) Transcriptional Activity Based on Structural (2D&3D) Properties
Prediction of secondary site mutations that reinstate mutated p53 to normalcy has been the focus of intense research in the recent past owing to the fact that p53 mutants have been implicated in more than half of all human cancers and restoration of p53 causes tumor regression. However laboratory investigations are more often laborious and resource intensive but computational techniques could w...
متن کاملTranscriptional functionality of germ line p53 mutants influences cancer phenotype.
PURPOSE The TP53 tumor suppressor gene encodes a sequence-specific transcription factor that is able to transactivate several sets of genes, the promoters of which include appropriate response elements. Although human cancers frequently contain mutated p53, the alleles as well as the clinical expression are often heterogeneous. Germ line mutations of TP53 result in cancer proneness syndromes kn...
متن کاملPredicting Transcriptional Activity of Multiple Site p53 Mutants Based on Hybrid Properties
As an important tumor suppressor protein, reactivate mutated p53 was found in many kinds of human cancers and that restoring active p53 would lead to tumor regression. In this work, we developed a new computational method to predict the transcriptional activity for one-, two-, three- and four-site p53 mutants, respectively. With the approach from the general form of pseudo amino acid compositio...
متن کاملanalysis of ruin probability for insurance companies using markov chain
در این پایان نامه نشان داده ایم که چگونه می توان مدل ریسک بیمه ای اسپیرر اندرسون را به کمک زنجیره های مارکوف تعریف کرد. سپس به کمک روش های آنالیز ماتریسی احتمال برشکستگی ، میزان مازاد در هنگام برشکستگی و میزان کسری بودجه در زمان وقوع برشکستگی را محاسبه کرده ایم. هدف ما در این پایان نامه بسیار محاسباتی و کاربردی تر از روش های است که در گذشته برای محاسبه این احتمال ارائه شده است. در ابتدا ما نشا...
15 صفحه اولذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
ژورنال
عنوان ژورنال: Molecular and Cellular Biology
سال: 1991
ISSN: 0270-7306,1098-5549
DOI: 10.1128/mcb.11.12.6067